View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15853_high_9 (Length: 216)
Name: NF15853_high_9
Description: NF15853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15853_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 75 - 200
Target Start/End: Original strand, 45544585 - 45544710
Alignment:
| Q |
75 |
atcttggattaggttttctgccagtgatggaaaaaagaaactaaaagggattattccttcaaatcagtactcagatgttctatctgggaagattcagaac |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45544585 |
atcttggattaggttttctgccagtgatggaaaaaagaaactaaaagggattattccttcaaatcagtactcagaagttctatctgggaagattcagaac |
45544684 |
T |
 |
| Q |
175 |
cttggtttaattcgaatccttgatta |
200 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
45544685 |
cttggtttaattcgaatccttgatta |
45544710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 78 - 131
Target Start/End: Original strand, 24001040 - 24001093
Alignment:
| Q |
78 |
ttggattaggttttctgccagtgatggaaaaaagaaactaaaagggattattcc |
131 |
Q |
| |
|
|||||||||||||||||| |||||||| |||| ||||||||||| |||||||| |
|
|
| T |
24001040 |
ttggattaggttttctgcgagtgatgggaaaacgaaactaaaagtaattattcc |
24001093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University