View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15853_low_12 (Length: 213)
Name: NF15853_low_12
Description: NF15853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15853_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 1 - 190
Target Start/End: Original strand, 54805963 - 54806152
Alignment:
| Q |
1 |
atgctgttgaaatgcacaattgttttgttactcttgacattgtattgcagatggaactgtctttcttctgccgtaccacaaaatgttgtagttgaaatgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
54805963 |
atgctgttgaaatgcacaattgttttgttactcttgacattgtattgtagatggaactgtctttcttctgccgtaccaaaaaatgttgtagttgaaatgt |
54806062 |
T |
 |
| Q |
101 |
tcttgtttaagctgcaaaatgactggataagtaattttttagtgtaaagtgtatctcatattaagtggttcatttgaatcagattctgta |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54806063 |
tcttgtttaagctgcaaaatgactggataagtaattttttagtgtaaagtgtatctcatattaagtggttcatttgaatcagattctgta |
54806152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University