View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15854_high_6 (Length: 227)
Name: NF15854_high_6
Description: NF15854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15854_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 2 - 102
Target Start/End: Original strand, 9560403 - 9560503
Alignment:
| Q |
2 |
catcacccatcattgacgaacattccaaacacgcccttaactttagcttaaaactaaaatgaatattattatatcattctaaacgcgaattcgaatttgg |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9560403 |
catcacccatcattgacgaacattccaaacacgcccttaactttagcttaaaactaaaatgaatattattatatcattctaaacgcgaattcgaatttgg |
9560502 |
T |
 |
| Q |
102 |
a |
102 |
Q |
| |
|
| |
|
|
| T |
9560503 |
a |
9560503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 158 - 227
Target Start/End: Original strand, 9560558 - 9560627
Alignment:
| Q |
158 |
ctgagaaagtgtgagaaagtttctgtaactagcttcaacggttttagcgggaaattagttttctcttcct |
227 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9560558 |
ctgagaaagtgtgagaaaatttctgtaactagcttcaacggttttagcgggaaattagttttctcttcct |
9560627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University