View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15856_high_19 (Length: 301)
Name: NF15856_high_19
Description: NF15856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15856_high_19 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 41 - 273
Target Start/End: Complemental strand, 12682625 - 12682393
Alignment:
| Q |
41 |
atagcttccaagaatctcttatgtaactcctcttgtttctcaacaacctccttcattagtctctcaaagaaatccttccatttcctcttcctcttccgcc |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12682625 |
atagcttccaagaatctcttatgtaactcctcttgtttctcaacaacctccttcattagtctctcaaagaaatccttccatttcctcttcctcttccgcc |
12682526 |
T |
 |
| Q |
141 |
gattcgatcccccttccattgtcgtcgtttcctcagaagaagttgaagacgaacttgaattcgagaagaaatctgttgaaatgttggggaatgatgatgg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12682525 |
gattcgatcccccttccattgtcgtcgtttcctcagaagaagttgaagacgaacttgaattcgagaagaaatctgttgaaatgttggggaatgatgatgg |
12682426 |
T |
 |
| Q |
241 |
tgggggtgttgtagtaatttgaggaatagggtt |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
12682425 |
tgggggtgttgtagtaatttgaggaatagggtt |
12682393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University