View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15856_high_25 (Length: 242)
Name: NF15856_high_25
Description: NF15856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15856_high_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 235
Target Start/End: Complemental strand, 34336015 - 34335798
Alignment:
| Q |
18 |
gttttggccatgataacatgtgtccctgccaaagccagcaccatagaacattgtctaaggttgaaactgaatccacctccaccagcaccgcgtgcggcac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34336015 |
gttttggccatgataacatgtgtccctgccaaagccagcaccatagaacattgtttaaggttgaaactgaatccacctccaccagcaccgcgtgcggcac |
34335916 |
T |
|
| Q |
118 |
ttggacatcgaacgaaatttgatttgaatcgcgttgtttgtaaggacgcttttcgtgccgtgggacattctgtgagggtaacagggaaattgccatggag |
217 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34335915 |
ttggacatggaacgaaatttgatttgaatcgcgttgtttgtaaggacgcttttcgtgccgtgggacattctgtgagggtaacagggaaattgccatggag |
34335816 |
T |
|
| Q |
218 |
ttacttaggtgccctttg |
235 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
34335815 |
ttacttaggtgccctttg |
34335798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University