View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15856_low_18 (Length: 350)
Name: NF15856_low_18
Description: NF15856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15856_low_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 98; Significance: 3e-48; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 13 - 186
Target Start/End: Complemental strand, 6937044 - 6936868
Alignment:
| Q |
13 |
agcataggcacgccatttttgctaataattaatataaatttannnnnnnacacaatcaattaatttacttaagtcatgtatggtnnnnnnnnta---gat |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||| | ||| |
|
|
| T |
6937044 |
agcataggcacgccatttttgctaataattaatataaatttatttttttacacaatcaattaatttacttaagtgatgtatggtaaaaaaaaaaaaagat |
6936945 |
T |
|
| Q |
110 |
gtttgataagctagctgatgacggataaactagcttatagtaaagaatatgttgccctattggatttatagtgtttg |
186 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6936944 |
gtttgataagttaactgatgacggataaactagcttatagtaaagaatatgttgccctattggatttataatgtttg |
6936868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 282 - 334
Target Start/End: Complemental strand, 6936771 - 6936719
Alignment:
| Q |
282 |
tgattaatttattggagataaagctcaattactaacatgagggacatagttag |
334 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6936771 |
tgattaatttattggagataaagctcaattactaacatgagggacatagttag |
6936719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University