View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15856_low_36 (Length: 212)
Name: NF15856_low_36
Description: NF15856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15856_low_36 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 50 - 197
Target Start/End: Original strand, 28102354 - 28102501
Alignment:
| Q |
50 |
aaactctgctgacagattttcttgtgtccccctctcttattcaagatcaaccaagttttgtggacatgccctttataaaatatataagtctagtcatgtc |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28102354 |
aaactctgctgacagattttcttgtgtccccctctcttattcaagatcaaccaagttttgtggacatgccctttataaaatatataagtctagtcatgtc |
28102453 |
T |
|
| Q |
150 |
atgagaaggttacttgtactgcatnnnnnnntaaaagatattcatagt |
197 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
28102454 |
atgagaaggttacttgtactgcataaaaaaataaaagatattcatagt |
28102501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University