View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15857_high_4 (Length: 229)
Name: NF15857_high_4
Description: NF15857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15857_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 5 - 219
Target Start/End: Original strand, 49040049 - 49040263
Alignment:
| Q |
5 |
tatgtaccgaatttcaaattggcatttgagcatttctgcatccatggaggtgggagatcagtgttggatgctatgcagaataatctagaactaagtgagt |
104 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
49040049 |
tatgtaccgaatttcaaattggcttttgagcatttctgcatccatgcaggtgggagatcagtgttggatgctatgcagaataatatagaactaagtgagt |
49040148 |
T |
 |
| Q |
105 |
ggcatatggagccatctcgttccacattacaccgctttggtaacacttcaagtagttcactttggtatgagttagcatacgtagaggccaagggtagagt |
204 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49040149 |
ggcatatggagccatcttgttccacattacatcgctttggtaacacttcaagtagttcactttggtatgagttagcatacgtagaggccaagggtagagt |
49040248 |
T |
 |
| Q |
205 |
ttcaaagggggatag |
219 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
49040249 |
ttcaaagggggatag |
49040263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 142 - 183
Target Start/End: Complemental strand, 19671813 - 19671772
Alignment:
| Q |
142 |
tggtaacacttcaagtagttcactttggtatgagttagcata |
183 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
19671813 |
tggtaacacttcaagtagttctgtttggtatgagttggcata |
19671772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 142 - 183
Target Start/End: Complemental strand, 19742933 - 19742892
Alignment:
| Q |
142 |
tggtaacacttcaagtagttcactttggtatgagttagcata |
183 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
19742933 |
tggtaacacttcaagtagttctgtttggtatgagttggcata |
19742892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 142 - 183
Target Start/End: Original strand, 19797155 - 19797196
Alignment:
| Q |
142 |
tggtaacacttcaagtagttcactttggtatgagttagcata |
183 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
19797155 |
tggtaacacttcaagtagttctgtttggtatgagttggcata |
19797196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University