View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15858_high_12 (Length: 304)
Name: NF15858_high_12
Description: NF15858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15858_high_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 1 - 167
Target Start/End: Complemental strand, 6362473 - 6362307
Alignment:
| Q |
1 |
tcacgacatgatggatgctgctcgaaaacgagcacaacgacgtgccgtttaccttgcaaaacgtcgtggtgatcctatgcaatcaattcaagtcgttggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6362473 |
tcacgacatgatggatgctgctcgaaaacgagcacaacgacgtgccgtttaccttgcaaaacgtcgtggtgatcctatgcaatcaattcaagtcgttggt |
6362374 |
T |
 |
| Q |
101 |
tctcgttctcgtgcttatcgtgatgacgcgctttatcaagccaccgaagatcaacaaggattgttag |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6362373 |
tctcgttctcgtgcttatcgtgatgacgcgctttatcaagccaccgaagatcaacaaggattgttag |
6362307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 242 - 286
Target Start/End: Complemental strand, 6362234 - 6362190
Alignment:
| Q |
242 |
ctataatttgggattaatggtgtaatttaggatcttttagatagt |
286 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6362234 |
ctataatttgggattaatggtgtcgtttaggatcttttagatagt |
6362190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University