View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15858_high_18 (Length: 227)
Name: NF15858_high_18
Description: NF15858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15858_high_18 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 22 - 227
Target Start/End: Original strand, 28552656 - 28552863
Alignment:
| Q |
22 |
tgaccatcttcttcaatttggtcggtta--tgatctttttaaaagtatttgatcgtcgttttatctgatatggtcagagacacccccttctggacaaaag |
119 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28552656 |
tgaccatcttcttcaatttggtcagttagatgatctttttaaaagtatttgatcgtcgttttatctgatatggtcagagacacccccttctggacaaaag |
28552755 |
T |
|
| Q |
120 |
tcagtagataactgcatatatgacatacatggggtttcagctgcagctaaggatcttgagcccgcttgacttgtaccgactctcaaaggcacctaaatcc |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
28552756 |
tcagtagataactgcatatatgacatacatggggtttcagctgcagctaaggatcttgaccccggttgacttgtaccgactctcaaaggcacctaaatcc |
28552855 |
T |
|
| Q |
220 |
accacctt |
227 |
Q |
| |
|
|||||||| |
|
|
| T |
28552856 |
accacctt |
28552863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University