View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15858_high_9 (Length: 318)
Name: NF15858_high_9
Description: NF15858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15858_high_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 40 - 307
Target Start/End: Original strand, 1753117 - 1753384
Alignment:
| Q |
40 |
aatgggaggaaccagagtgcaaaggctttctggaatgcaaaagcaagtgcttagcttatacagaggatttcttcgtgcagcacgttccaaaccagacgaa |
139 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||| || |
|
|
| T |
1753117 |
aatgggaggaaccagagtgcaaaggctatctggaatgcaaaagcaagtgcttagcttatacagaggatttcttcgtgctgcacgttccaaaccggaccaa |
1753216 |
T |
|
| Q |
140 |
gaacgccgcaacatagaatccatagtatctcaagaatttcgtcacaattcaaaacaagttgataggaagaattttcaatacattgaatatttacttcgcc |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1753217 |
gaacgccgcaacatagaatccatagtatctcaagaatttcgtcacaattcaaaagaagttgataggaagaattttcaatacattgaatatttacttcgcc |
1753316 |
T |
|
| Q |
240 |
gtggtcataaacagcttcatcagcttaacaaccctggtaccaccgggttatcttcattgcaacttcat |
307 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1753317 |
gtggtcataaacagcttgatcagcttaacaaccctggtaccaccgggttatcttcattgcaacttcat |
1753384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University