View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15859_low_2 (Length: 300)
Name: NF15859_low_2
Description: NF15859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15859_low_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 99 - 291
Target Start/End: Original strand, 52113520 - 52113712
Alignment:
| Q |
99 |
tctattggagtaattggagttnnnnnnnatgtcttatctgggttggacactgatgctttcaatggagtgactgaaattggaatgaaaggacatttggaaa |
198 |
Q |
| |
|
|||||||||||||||||| || ||||| |||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
52113520 |
tctattggagtaattggaattggggaggatgtcgtatctgggttggacactgatgctttcaatggagtcgctgaaattggagtgaaaggacatttggaaa |
52113619 |
T |
 |
| Q |
199 |
tggagcagcgattgcggtgttttatcgttctttttaatgcaaattctggttgaaggaaagtataagatattgaggaggtaagtgatgatgatg |
291 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52113620 |
tggagcagcgattgtggtgttttatcgttcttttaaatggaaattctggttgaaggaaagtataagatattgaggaggtaagtgatgatgatg |
52113712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 74
Target Start/End: Original strand, 52113425 - 52113498
Alignment:
| Q |
1 |
cagggattcttcgcattgaaagttttttgggtggttcgggtgaaactaatgacgatgttgtgtctgtgccggac |
74 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52113425 |
cagggattcttcgcattggaagttttttgggtggttcgggtgaaactaatgacgatgttgtgtctgtgccggac |
52113498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University