View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15860_high_18 (Length: 218)
Name: NF15860_high_18
Description: NF15860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15860_high_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 97; Significance: 8e-48; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 6 - 106
Target Start/End: Original strand, 44221358 - 44221458
Alignment:
| Q |
6 |
caccggtttcccagtgaatgtcggccaccagcctaatgccaaccaggaatggtccacgggtctatttgactgcttctccgactgcaaaacttgtatgtta |
105 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44221358 |
caccggtttcccggtgaatgtcggccaccagcctaatgccaaccaggaatggtccacgggtctatttgactgcttctccgactgcaaaacttgtatgtta |
44221457 |
T |
 |
| Q |
106 |
t |
106 |
Q |
| |
|
| |
|
|
| T |
44221458 |
t |
44221458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University