View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15860_high_6 (Length: 314)
Name: NF15860_high_6
Description: NF15860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15860_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 13 - 298
Target Start/End: Complemental strand, 37633713 - 37633428
Alignment:
| Q |
13 |
tgaaggagtcaccggatttagcagaaaccggagatacagcgtagaagtatttagcgagctgcgacggcgagccggtaacgtcgaagttctcggcggcgta |
112 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37633713 |
tgaaggagtcacctgatttagcagaaaccggagatacagcgtagaagtatttagcgagctgcgacggcgagccggtaacgtcgaagttctcggcggcgta |
37633614 |
T |
|
| Q |
113 |
gggttgaaaacctggactcaccgttgttgattggagataacgtagtcctctgttatcatccaactcgaccatcaatggcgaaacgttctcgttcgaagtc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37633613 |
gggttgaaaacctggactcaccgttgttgattggagataacgtagtcctctgttatcatccaactcgaccatcaatggcgaaacgttctcgttcgaagtc |
37633514 |
T |
|
| Q |
213 |
ctcaacttcgaaaccttcttcatcttgctgttgttcatcgaaaccagttcctgcatgtcaaaaacgaagctcgaatcacgatttgt |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37633513 |
ctcaacttcgaaaccttcttcatcttgctgttgttcatcgaaaccaattcctgcatgtcaaaaacgaagctcgaatcacaatttgt |
37633428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University