View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15860_low_11 (Length: 296)
Name: NF15860_low_11
Description: NF15860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15860_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 146 - 281
Target Start/End: Original strand, 53040021 - 53040156
Alignment:
| Q |
146 |
atccgtgtagacgtgtccgtgtcattaatgtgtctggtgtctgtatatttgtttgtgcttcatagacgcattgaattattgaaattgtgcttgaacaatt |
245 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53040021 |
atccgtgtagacgtgtccgtgtcattagtgtgtctggtgtctgtatatttgtttgtgtttcatagacgcattgaattattgaaattgtgcttgaacaatt |
53040120 |
T |
 |
| Q |
246 |
ttgttttgtctgttatattggatctgttcctattcc |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
53040121 |
ttgttttgtctgttatattggatctgttcctattcc |
53040156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 19 - 113
Target Start/End: Original strand, 53039885 - 53039979
Alignment:
| Q |
19 |
gtaggtacttctctatccattttcattttcatttcttaaattccaaattcttacaacaattggaatgcattgcttggtgtgtccgacacgacacc |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
53039885 |
gtaggtacttctctatccattttcattttcatttcttaaattccaaattcttacaacaattggaatgcattgcttggcgtgtccgacatgacacc |
53039979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University