View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15860_low_15 (Length: 238)
Name: NF15860_low_15
Description: NF15860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15860_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 18 - 225
Target Start/End: Original strand, 20015131 - 20015338
Alignment:
| Q |
18 |
tgtcaatgactaggaaagtcggtgacgggaataagacacatgcatagatgagacaggtacatgaggtacaattttaacttttaagcnnnnnnnnngtaca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
20015131 |
tgtcaatgactaggaaagtcggtgacgggaataagacacatgcatagatgagacaggtacatgaggtacaattttaacttttaagcaaaaaaaaagtaca |
20015230 |
T |
 |
| Q |
118 |
gaaatggttcttttaaatccaatggatattaatacaggaatggttcttttaaatctaatggatattaatcgttccttttatcttataataagttatttac |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
20015231 |
gaaatggttcttttaaatccaatggatattaatacaggaatggttcttttaaatctaatggatattaatcgttccttttatcttataataaaacatttat |
20015330 |
T |
 |
| Q |
218 |
tatgtttc |
225 |
Q |
| |
|
|||||||| |
|
|
| T |
20015331 |
tatgtttc |
20015338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University