View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15860_low_19 (Length: 227)
Name: NF15860_low_19
Description: NF15860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15860_low_19 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 38635030 - 38634804
Alignment:
| Q |
1 |
aactcatgccggaaacgttctatctgactctcaacattgttgaccgattcttgtccacaaaggctgtacctagaaaggaacttcagcttgttggcataag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38635030 |
aactcatgccggaaacgttctatctgactctcaacattgttgaccgattcttgtccacaaaggctgtacctagaaaggaacttcagcttgttggcataag |
38634931 |
T |
|
| Q |
101 |
ctcaatgcttattgcatcaaagtatgaagagatttgggcaccagaggtagaactccttttatcttgtatatggtttatcaaatgtgtctatatgctatat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38634930 |
ctcaatgcttattgcatcaaagtatgaagagatttgggcaccagaggtagaactccttttatcttgtatatggtttatcaaatgtgtctatatgctatat |
38634831 |
T |
|
| Q |
201 |
ggtttattgaatgtctttgtttcattt |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
38634830 |
ggtttattgaatgtctttgtttcattt |
38634804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 3 - 53
Target Start/End: Complemental strand, 38617854 - 38617804
Alignment:
| Q |
3 |
ctcatgccggaaacgttctatctgactctcaacattgttgaccgattcttg |
53 |
Q |
| |
|
|||||||| ||||| |||||||||||||| || |||||||| ||||||||| |
|
|
| T |
38617854 |
ctcatgccagaaactttctatctgactcttaatattgttgatcgattcttg |
38617804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University