View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15860_low_21 (Length: 207)
Name: NF15860_low_21
Description: NF15860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15860_low_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 45; Significance: 8e-17; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 136 - 188
Target Start/End: Original strand, 498604 - 498656
Alignment:
| Q |
136 |
tcattgtttctaattgttatgagcgatttttcagcattaagtggaattccaat |
188 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
498604 |
tcattgtttctaattgttatgagtgatttttcagcaataagtggaattccaat |
498656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 18 - 57
Target Start/End: Original strand, 496620 - 496659
Alignment:
| Q |
18 |
agatccagagtcgtaagagatgtcatattatcaatgatgt |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
496620 |
agatccagagtcgtaagagatgtcatattatcaaagatgt |
496659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 67 - 95
Target Start/End: Original strand, 496633 - 496661
Alignment:
| Q |
67 |
taagagatgtcatattatcaaagatgtta |
95 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
496633 |
taagagatgtcatattatcaaagatgtta |
496661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University