View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15861_low_5 (Length: 253)
Name: NF15861_low_5
Description: NF15861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15861_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 18 - 242
Target Start/End: Complemental strand, 19188532 - 19188308
Alignment:
| Q |
18 |
ccattcataataattgtggtgaatgtataggatgtcgaagattctcacacttgagaagaaaattgttgcattcaagtgtgagtagatagtccaacatcta |
117 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19188532 |
ccattcataataattatggtgaatgtataggatgtcgaagactctcacacttgagaagaaaattgttgcattcaagtgtgagtagatagtccaacatcta |
19188433 |
T |
 |
| Q |
118 |
ttatgaatgaaataattaatctatataagagaaatgatccctattatcaatatcttacaattttggatcaacatggcgactctctcgctcttataggcat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19188432 |
ttatgaatgaaataattaatctatataagagaaatgatccctatgatcaatatcttacaattttggatcaacatggcgactctctcgctcttataggcat |
19188333 |
T |
 |
| Q |
218 |
gaagcattgaccctttattattctt |
242 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
19188332 |
gaagcattgaccctttattattctt |
19188308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University