View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15862_low_9 (Length: 247)
Name: NF15862_low_9
Description: NF15862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15862_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 16 - 236
Target Start/End: Complemental strand, 40343379 - 40343161
Alignment:
| Q |
16 |
attttaaccttacactcaaaaataggatttgatctcattctttcttacgattgatgcacaaatcaacggcatgcaagatggcaagtatgttacttacatc |
115 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40343379 |
attttaaccttacactcaaaaataggacttgatctcattctttcttacgattgatgcacaaatcaacggcatgcaagatggcaagtatg----ttacatc |
40343284 |
T |
 |
| Q |
116 |
atgtgacatgttattgtcttgtca--nnnnnnnnattagtataaatcaccaacnnnnnnncgaaatcaccaacttgggttaagttccaatacccatcatt |
213 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40343283 |
atgtgacatgttattgtcttgtcattttttttttattagtagaaatcaccaactttttttcgaaatcaccaacttgggttaagttccaatacccatcatt |
40343184 |
T |
 |
| Q |
214 |
taaattaacgctcacacaggttc |
236 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
40343183 |
taaattaacgctcacacaagttc |
40343161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University