View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15863_low_8 (Length: 222)

Name: NF15863_low_8
Description: NF15863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15863_low_8
NF15863_low_8
[»] chr5 (1 HSPs)
chr5 (1-222)||(7559293-7559514)


Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 7559514 - 7559293
Alignment:
1 tctagccaaaacactgatcagcagggagaggacctggaatgtaaccttgttgaaaatactgcaaaccaaaaacaacaacaatagcaaccaatgccaaata 100  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7559514 tctagccaaaacactgatcagcagggagaggacctggaatataaccttgttgaaaatactgcaaaccaaaaacaacaacaatagcaaccaatgccaaata 7559415  T
101 tgacaacccttcaacagcacctaataacccaaaaggaccattaggaagaccagaaccagtttttgttttagtatatatagaccaagcaacaatgcccaca 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7559414 tgacaacccttcaacagcacctaataacccaaaaggaccattaggaagaccagaaccagtttttgttttagtatatatagaccaagcaacaatgcccaca 7559315  T
201 acaacaagataacttacacctt 222  Q
    ||||||||||||||||||||||    
7559314 acaacaagataacttacacctt 7559293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University