View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15864_high_46 (Length: 253)
Name: NF15864_high_46
Description: NF15864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15864_high_46 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 13 - 234
Target Start/End: Original strand, 29015322 - 29015543
Alignment:
| Q |
13 |
aagaatatgtttggagtcactagattcaggaaatcatcaaatagtacaactccccgattttcctggcggagaagaagcatttgaactctgcgcaaaattc |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29015322 |
aagattatgtttggagtcactagattcaggaaatcatcaaatagtacaactccccgattttcctggcggagaagaagcatttgaactctgcgcaaaattc |
29015421 |
T |
 |
| Q |
113 |
tgctatggaatcacaatcactctaagtgcttacaacattgtatccacaagatgtgccgcggaatatttacaaatgacagaagatgcagaaaagggtaact |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29015422 |
tgctatggaatcacaatcactctaagtgcttacaacattgtatccacaagatgtgccgcggaatatttacaaatgacagaagatgcagaaaagggtaact |
29015521 |
T |
 |
| Q |
213 |
tgatttacaagcttgaagtttt |
234 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
29015522 |
tgatttacaagcttgaagtttt |
29015543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 45 - 236
Target Start/End: Original strand, 14128867 - 14129058
Alignment:
| Q |
45 |
atcatcaaatagtacaactccccgattttcctggcggagaagaagcatttgaactctgcgcaaaattctgctatggaatcacaatcactctaagtgctta |
144 |
Q |
| |
|
|||| |||||||| ||||| || |||||||| || |||| ||||||||||| | || || || ||||||||||||||| ||| ||| ||||| |||| |
|
|
| T |
14128867 |
atcaccaaatagttcaacttcctgattttccgggtggagtggaagcatttgagttgtgtgctaagttctgctatggaatccaaattactttaagtcctta |
14128966 |
T |
 |
| Q |
145 |
caacattgtatccacaagatgtgccgcggaatatttacaaatgacagaagatgcagaaaagggtaacttgatttacaagcttgaagttttct |
236 |
Q |
| |
|
|||||||||| | |||||||||| || |||||| | |||||||| ||||| | ||||| || ||||||||| |||||||||| ||||||| |
|
|
| T |
14128967 |
caacattgtagctgcaagatgtgctgctgaatatctccaaatgactgaagaagttgaaaaaggaaacttgattcacaagcttgaggttttct |
14129058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University