View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15864_high_57 (Length: 213)
Name: NF15864_high_57
Description: NF15864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15864_high_57 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 20 - 200
Target Start/End: Original strand, 29319093 - 29319273
Alignment:
| Q |
20 |
agactttgcaaagaagaaccaagtagtgaattccaaaccaaataaaacacaaacatatagatggagagaggattatacctatcaaaatagagtgcaaaag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29319093 |
agactttgcaaagaagaaccaagtagtgaattccaaaccaaataaaacacaaacatatagatggagagaggattatacctatcaaaatagagtgcaaaag |
29319192 |
T |
 |
| Q |
120 |
gggttataacaatgaatgcaacggcatggcggtacacaacaaatacatagttgctcattcctctgttcaatgcagcctttg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29319193 |
gggttataacaatgaatgcaacggcatggcggtacacaacaaatacatagttgctcattcctctgttcaatgcagcctttg |
29319273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University