View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15864_high_59 (Length: 209)
Name: NF15864_high_59
Description: NF15864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15864_high_59 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 20 - 191
Target Start/End: Complemental strand, 28093980 - 28093809
Alignment:
| Q |
20 |
ggatgcaatgttgctcgaaatagaacaaatgtgtctggatttgtataagaaaaaagtggacgaagctaaactgcataaggcacaacttcagcatcaaatt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28093980 |
ggatgcaatgttgctcgaaatagaacaaatgtgtctggatttgtataagaaaaaagtggatgaagctaaactgcataaggcacaacttcagcatcaaatt |
28093881 |
T |
 |
| Q |
120 |
gctgattatgaagaagaaattgctggcatttgtgctgcaattggtgaacagtcaccacttgtaagtcttgtt |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28093880 |
gctgattatgaagaagaaattgctggcatttgtgctgcaattggtgaacaatcaccacttgtaagtcttgtt |
28093809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University