View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15864_low_12 (Length: 549)
Name: NF15864_low_12
Description: NF15864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15864_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 131 - 364
Target Start/End: Complemental strand, 45564693 - 45564464
Alignment:
| Q |
131 |
gcatttggcacgtgtacgtacacaggtcgcaaagttaaaccccctcgtccttacttgtttgtgggtgtgctcaaaacaagagaacccaaaaaccctaaaa |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45564693 |
gcatttggcacgtgtacgtacacaggtcgcaaagttaaaaccccacgtccttacttgt----gggtgtgctcaaaacaagagaacccaaaaaccctaaaa |
45564598 |
T |
 |
| Q |
231 |
ccctcttttgctttctctatctctctcgcatcaatggccgactcaatcttctcgattcagtacctcaaaaacttcatcagttctcaaatccatgacgacg |
330 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45564597 |
ccctcttttgctttctctctctctctcgcatcaatggccgactcaatcttctcgattcagtacctcaaaaacttcatcagttctcaaatccatgacgacg |
45564498 |
T |
 |
| Q |
331 |
agaaatgggacttcaacgtggtaaacttttctct |
364 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
45564497 |
agaaatgggacttcaacgtggtaaacttttctct |
45564464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 445 - 534
Target Start/End: Complemental strand, 45564371 - 45564282
Alignment:
| Q |
445 |
atgttagtatgtgattgattgaatacgatgtctattttgattatttgttatgttctgggattgattagataattatgtgtgtgccctatg |
534 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45564371 |
atgttagtatgtgattgattgaatactatgtgtattttgattatttgttatgttctgggattgattagataattatgtgtctgccctatg |
45564282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University