View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15864_low_23 (Length: 395)
Name: NF15864_low_23
Description: NF15864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15864_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 111; Significance: 6e-56; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 111; E-Value: 6e-56
Query Start/End: Original strand, 217 - 375
Target Start/End: Complemental strand, 45564917 - 45564760
Alignment:
| Q |
217 |
ttacgaacagtatattggtatgagtgaaactgaactcagatttcttaagcaaaattgtagttttatgtcagatagacaccgttaaattttctgatgaaat |
316 |
Q |
| |
|
||||||||||| ||||||| ||| |||||||| ||||||||| |||||| |||||||||||||||||||||||| ||||| |||||||||| |||||||| |
|
|
| T |
45564917 |
ttacgaacagt-tattggtgtgaatgaaactggactcagattccttaagtaaaattgtagttttatgtcagataaacaccattaaattttccgatgaaat |
45564819 |
T |
 |
| Q |
317 |
gaaaactattaattggtaaagttgatgtatatttcgtatcgataatttatctaaaataa |
375 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45564818 |
gaaaactactaattggtaaagttgatgtatattttgtatcgataatttatctaaaataa |
45564760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 32 - 155
Target Start/End: Complemental strand, 45565114 - 45564986
Alignment:
| Q |
32 |
tttgatacaatttctaatggatttttctctttaaaaaaccccaataatgtttaggatgtatgtaatttctgtttttaatctacatgatc-----taatat |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45565114 |
tttgatacaatttctaatggatttttctctttaaaaaaccccaataatgtttaggatgtatgtaatttctgtttttaatctacatgatctaatctaatat |
45565015 |
T |
 |
| Q |
127 |
aataattgaagatatatatttcacatgac |
155 |
Q |
| |
|
||||||||||||| ||||||||||||||| |
|
|
| T |
45565014 |
aataattgaagatctatatttcacatgac |
45564986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University