View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15864_low_25 (Length: 388)
Name: NF15864_low_25
Description: NF15864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15864_low_25 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 138; Significance: 5e-72; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 138; E-Value: 5e-72
Query Start/End: Original strand, 148 - 345
Target Start/End: Original strand, 379021 - 379218
Alignment:
| Q |
148 |
catatatggaccacatgaactgagttaagaacgacggaatttccataactcttttaggcaagaacagacgaagaagaatgtagaggaagggagagtgggc |
247 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||| ||| ||||||||||||||| ||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
379021 |
catatatggaccgcatgaaccgagttaagaacaacgaaatttccataactctgttaggcaagaacagacgcaaaagaatgtagaggaagggagagtgggc |
379120 |
T |
|
| Q |
248 |
acaagcaagggtaggcgccgcaatgctgatgtatctggaccagtggcggatcttgactaaagatgttgagggtgtcaaatatttgtataacgcacaca |
345 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||| ||||||||||||||||||||||||||||||||| || || |||||||||||| ||| |||||| |
|
|
| T |
379121 |
acaagcaagggtaggcgccacaatgctgatctatttggaccagtggcggatcttgactaaagatgttggggctgccaaatatttgtaaaacacacaca |
379218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 23 - 87
Target Start/End: Original strand, 378896 - 378960
Alignment:
| Q |
23 |
ttcagattatataatccgaaacagtttcttaatttggattatataatctgaactgcttcagtata |
87 |
Q |
| |
|
||||||||||||||||||||||| |||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
378896 |
ttcagattatataatccgaaacaatttcccagtttggattatataatctgaactgcttcagtata |
378960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University