View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15864_low_32 (Length: 354)
Name: NF15864_low_32
Description: NF15864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15864_low_32 |
 |  |
|
| [»] scaffold0393 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 254 - 297
Target Start/End: Original strand, 2411287 - 2411330
Alignment:
| Q |
254 |
taagttttttgggtgctatgatacaccacgtagtgtaaaacata |
297 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2411287 |
taagttttttgggtgctatgatacaccatgtagtgtaaaacata |
2411330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0393 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0393
Description:
Target: scaffold0393; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 256 - 296
Target Start/End: Original strand, 13671 - 13710
Alignment:
| Q |
256 |
agttttttgggtgctatgatacaccacgtagtgtaaaacat |
296 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
13671 |
agttttttgggtg-tatgatacaccatgtagtgtaaaacat |
13710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University