View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15864_low_33 (Length: 339)
Name: NF15864_low_33
Description: NF15864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15864_low_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 1 - 324
Target Start/End: Original strand, 43150708 - 43151031
Alignment:
| Q |
1 |
aataatgttgtaagatatatatagaataaacaacaacaatttaataattaacaactggtgcaaaagaagtgaggttcttggcgtcccgctcggtcgtttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43150708 |
aataatgttgtaagatatatatagaataaacaacaacaatttaataattaacaactggtgcaaaagaagtgaggttcttggcgtcccggtcggtcgtttc |
43150807 |
T |
 |
| Q |
101 |
ccacacaacggctttataagtcttagaatgagaactgtcattggcggaaaggatgaggcggtagttgatccattcaacaaccatggattcagccttgata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43150808 |
ccacacaacggctttataagtcttagaatgagaaccgtcattggcggaaaggatgaggcggtagttgatccattcaacaaccatggattcagccttgata |
43150907 |
T |
 |
| Q |
201 |
atcttctcaaatttcagcttcgacccagtttgcttgtcgtactcagtaacggcaaaattgcaaagatctatcatgtatggttcgtagatgttgattgggt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43150908 |
atcttctcaaatttcagcttcgacccagtttgctagtcgtactcagtaacggcaaaattgcaaagatctatcatgtatggttcgtagatgttgattgggt |
43151007 |
T |
 |
| Q |
301 |
cccaaccacggacaataagttgct |
324 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
43151008 |
cccaaccacggacaataagttgct |
43151031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University