View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15864_low_44 (Length: 282)
Name: NF15864_low_44
Description: NF15864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15864_low_44 |
 |  |
|
| [»] scaffold0066 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 9 - 268
Target Start/End: Original strand, 7425913 - 7426172
Alignment:
| Q |
9 |
agcagagacatctcattttgaatgcagatatagcaaggcgctgacagcaatattggtggtattgcaacagtataattcattaattgagaaaatatttttt |
108 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7425913 |
agcagggacatctcattttgaatgcagatatagcaaggcgctgacagcaatattggtggtattgcaacagtataattcattaattgagaaaatatttttt |
7426012 |
T |
 |
| Q |
109 |
ctttctcagggcatattaagatgttattctattctcttaaatggcagcagcatttgcaagttgttttcaaaattatgcgttaaattttcaacaattgcaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7426013 |
ctttctcagggcatattaagatgttattctattctcttaaatggcagcagcatttgcaagttgttttcaaaattatgcgttaaatttttaacaattgcaa |
7426112 |
T |
 |
| Q |
209 |
tcttggcaaaccatggggaaaagctttagcttcaagagtggaaatataggtagcaatgtg |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7426113 |
tcttggcaaaccatggggaaaagctttagcttcaagagtggaaatattggtagcaatgtg |
7426172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0066 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: scaffold0066
Description:
Target: scaffold0066; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 17 - 226
Target Start/End: Complemental strand, 17793 - 17587
Alignment:
| Q |
17 |
catctcattttgaatgcagatatagcaaggcgctgacagcaatattggtggtattgcaacagtataattcattaattgagaaaatattttttctttctca |
116 |
Q |
| |
|
||||||| ||||| |||| ||||||||||| |||| |||||| ||||||||||| ||||||| ||||| ||||||||||||| |||| |||| ||| |
|
|
| T |
17793 |
catctcagtttgattgcatatatagcaaggtgctggcagcaacattggtggtatcctaacagtagaattccttaattgagaaaagattt---ctttgtca |
17697 |
T |
 |
| Q |
117 |
gggcatattaagatgttattctattctcttaaatggcagcagcatttgcaagttgttttcaaaattatgcgttaaattttcaacaattgcaatcttggca |
216 |
Q |
| |
|
||||| || || |||| ||||||||||||||||||||||||| | | |||||||||| |||||| ||||||||||| || |||||||||| || | |
|
|
| T |
17696 |
gggcaggttgagttgttcagctattctcttaaatggcagcagcatctttatgttgttttcatcattatgtgttaaattttcgactattgcaatctcggga |
17597 |
T |
 |
| Q |
217 |
aaccatgggg |
226 |
Q |
| |
|
||| |||||| |
|
|
| T |
17596 |
aactatgggg |
17587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University