View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15864_low_45 (Length: 278)
Name: NF15864_low_45
Description: NF15864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15864_low_45 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 6e-86; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 16 - 192
Target Start/End: Original strand, 34903811 - 34903987
Alignment:
| Q |
16 |
attttccaccctcatttcattctggagtcatttttggtgatgttgtatattcattaatgacgagacaacgattatgtggtcaccttgatttttctatggg |
115 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34903811 |
atttttcaccctcatttcattctggagtgatttttggcaatgttgtatattcattaatgacgagacaacgattatgtggtcaccttgatttttctatggg |
34903910 |
T |
|
| Q |
116 |
cactactccttttaactaattaggtgtttccattttcaaagacaaatcgaaaatgagacatttgccacaaatagttg |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34903911 |
cactactccttttaactaattaggtgtttccattttcaaagacaaatcgaaaatgagacatttgccacaaatagttg |
34903987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 194 - 267
Target Start/End: Original strand, 34904087 - 34904159
Alignment:
| Q |
194 |
aatcatattaatagttgcttgagaaattttatttggaccagtggtgttaaccgctaggaaactagtcaatctct |
267 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
34904087 |
aatcatattgatagttgcttgagaaattttatttggaccagtggtgttaa-cggtaggaaactagtcaatctct |
34904159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University