View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15864_low_56 (Length: 235)
Name: NF15864_low_56
Description: NF15864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15864_low_56 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 74 - 177
Target Start/End: Complemental strand, 13153486 - 13153383
Alignment:
| Q |
74 |
acgtgtggtgcatttttgtaccctaaatttagtcaaaaacactacttttgtcttctaattcaaatgtttaaacaatttacatggtatgattgtttgtcat |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13153486 |
acgtgtggtgcatttttgtaccctaaatttagtcaaaaacactacttttgtcctctaatttaaatgtttaaacaatttacatggtatgattgtttgtcat |
13153387 |
T |
|
| Q |
174 |
agtc |
177 |
Q |
| |
|
|||| |
|
|
| T |
13153386 |
agtc |
13153383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 20 - 55
Target Start/End: Complemental strand, 13153519 - 13153484
Alignment:
| Q |
20 |
caaattacaaatgctcaaggctaggtcccacatacg |
55 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
13153519 |
caaattacaaatgctcaaggctaagtcccacatacg |
13153484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University