View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15864_low_60 (Length: 227)
Name: NF15864_low_60
Description: NF15864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15864_low_60 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 7 - 205
Target Start/End: Original strand, 44681593 - 44681791
Alignment:
| Q |
7 |
tccacttggactattcaaagttgcaatcactgtctctttcatttttcccctcattgttctacttcctagatcaggt-aaaaaatgtctctcataaccttt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
44681593 |
tccacttggactattcaaagttgcaatcactgtctctttcatttttcccctcattgttctacttcctagatcaggtaaaaaaatgtctctcgtaaccttt |
44681692 |
T |
 |
| Q |
106 |
tcactaacatgtctagtgtctctcattatcttttactcttattcttccgtctttagaatgacagtgagtttgatgaaatcacggtaatataccatgatac |
205 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
44681693 |
tcactaacatgtctagtgtctctctttatc-tttactcttattcttccgtctttagaatgacagtgagtttgatgaaatcacgttaatataccatgatac |
44681791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University