View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15865_low_2 (Length: 209)
Name: NF15865_low_2
Description: NF15865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15865_low_2 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 35072605 - 35072809
Alignment:
| Q |
1 |
cattatcaatcactagtattatgtggcaccaaaatagtgacccaaaacaaagcaaataatgcagttaataacacgtcttagaatcatctctttgttgctc |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35072605 |
cattatcaatcacttgtattatgtggcaccaaaatagtgacccaaaacaaagcaaacaatgcagttaataacacgtcttagaatcatctctttgttgctc |
35072704 |
T |
|
| Q |
101 |
ataatccgtgaacgtcattgccttttcaattttcacttcttaaggatactcactctatcgtccatttattcattcatgttatagttgtactataccatgc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35072705 |
ataatccgtgaacgtcattgccttttcaattttcacttcttaaggat----actctatcgtccatttattcattcatgttatagttgtactataccatgc |
35072800 |
T |
|
| Q |
201 |
ttacatatt |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
35072801 |
ttacatatt |
35072809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University