View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15866_high_2 (Length: 399)
Name: NF15866_high_2
Description: NF15866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15866_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 338; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 338; E-Value: 0
Query Start/End: Original strand, 1 - 374
Target Start/End: Original strand, 35409719 - 35410092
Alignment:
| Q |
1 |
ttaggaattaattttcgcattaattgtggccggattggaacatatccaccataggggtattgactgaagttcaagacagcatgttgcgctgatacagtcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35409719 |
ttaggaattaattttcgcattaattgtggccggattggaacatatccaccataggggtattgactgaagttcaagacagcatgttgcgctgatacagtcc |
35409818 |
T |
 |
| Q |
101 |
agataatggtggtaagcaaggagatgagatcctcaggggtgtttagtttaggacaccaggtagcatttttatgatcagggtgccccatgttgatgaattc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35409819 |
agataatggtggtaagcaaggagatgagatcctcaggggtgtttagtttaggccaccaggtagcatttttatgatcagggtgccccatgttgatgaattc |
35409918 |
T |
 |
| Q |
201 |
tttgtaccaggactggagttcattgtcagaagaaacggcatttaaatctttgtagtaatggttcacacaggtcctgaccaacttctctatactagtccat |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
35409919 |
tttgtaccaggactggagttcattgtcagaagaaatggcattcaaatctttgtagtaatggttcacataggtcctgaccaacttctctatactagaccat |
35410018 |
T |
 |
| Q |
301 |
atggggagtccatcagccgcataaggataatcttcagtaagtagtctaatgccatatggctgagtggcatctgg |
374 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||| |||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
35410019 |
atgaggagtccatcagccgcataaggataatcttcaataagtagtctaatgccatgtggccgagtggcatctgg |
35410092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University