View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15867_low_1 (Length: 326)
Name: NF15867_low_1
Description: NF15867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15867_low_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 14 - 311
Target Start/End: Complemental strand, 6038790 - 6038493
Alignment:
| Q |
14 |
ttctaacatcataaagagaatggaaataagaaaagaaagtcataggtgagttggtcaatttctcttatgttctattttttgtcggtttttccatcatttg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
6038790 |
ttctaacatcataaagagaatggaaataagaaaagaaagtcataggtgagttggtcaatttctcttatgttctattttttgtcggtttctccaccatttg |
6038691 |
T |
|
| Q |
114 |
atgacgagttttcacctcaccgtcttaaacctcaaatggacaacaacaaaaatgaattggatcaccgatcatgttggtttatcatgttatggtctaattc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6038690 |
atgacgagttttcacctcaccgtcttaaacctcaaatggacaataacaaaaatgaattggatcaccgatcgtgttggtttatcatgttatggtctaattc |
6038591 |
T |
|
| Q |
214 |
acatgtcactcctcctaatattttggacacgatttgcccctgattcaataacaatttttgacacaaatatgtgtcccgtattgatatcatatataaat |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6038590 |
acatgtcactcctcctaatattttggacacgatttgcaactgattcaataacaatttttgacacaaatatgtgtcccgtattgatatcatatataaat |
6038493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University