View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15868_high_22 (Length: 316)
Name: NF15868_high_22
Description: NF15868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15868_high_22 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 14 - 316
Target Start/End: Complemental strand, 43964321 - 43964020
Alignment:
| Q |
14 |
cagagaaagttgctttatatgggcttgtatcttctaatatggggtgaagcgtccaatcttcgcttcatgccagagtgtatatgctacatatttcacaatg |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43964321 |
cagagaaagttgctttatatgggcttgtatcttctcatatggggtgaagcgtccaatcttcgcttcatgccagagtgtatatgctacatatttcacaatg |
43964222 |
T |
|
| Q |
114 |
tgagcacattgttttcatacatttcacagtatcttgggctagattatctttgcatatgaaatgcaactcnnnnnnnnnnattaagaaaaatagtatatta |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43964221 |
tgagcacattgttttcatacatttcacagtatcttgggctagattatctttggatatgaaatgcaactc-tttttttttattaagaaaaatagtatatta |
43964123 |
T |
|
| Q |
214 |
ataatgtttaactctaacttcagatggcatatgaacttcatggtttattggctggaaatgtcagcattgttactggtgaaaatatcaaaccttcttatgg |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43964122 |
ataatgtttaactctaacttcagatggcatatgaacttcatggtttattggctggaaatgtcagcattgttactggtgaaaatatcaaaccttcttatgg |
43964023 |
T |
|
| Q |
314 |
tgg |
316 |
Q |
| |
|
||| |
|
|
| T |
43964022 |
tgg |
43964020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 72; Significance: 9e-33; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 233 - 316
Target Start/End: Complemental strand, 39166603 - 39166520
Alignment:
| Q |
233 |
tcagatggcatatgaacttcatggtttattggctggaaatgtcagcattgttactggtgaaaatatcaaaccttcttatggtgg |
316 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
39166603 |
tcagatggcatatgaactgcatggtttattggctggaaatgtcagcattgtcactggtgaaaatatcaagccttcttatggtgg |
39166520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 12 - 117
Target Start/End: Complemental strand, 39166841 - 39166736
Alignment:
| Q |
12 |
agcagagaaagttgctttatatgggcttgtatcttctaatatggggtgaagcgtccaatcttcgcttcatgccagagtgtatatgctacatatttcacaa |
111 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||||| || |||||||||||||| ||| |||| ||||||||||||||| | ||||| ||||||||||| |
|
|
| T |
39166841 |
agcagaggaagttgctttatatgggattgtatcttctcatttggggtgaagcgtcaaatgttcgattcatgccagagtgtctgtgctatatatttcacaa |
39166742 |
T |
|
| Q |
112 |
tgtgag |
117 |
Q |
| |
|
|||||| |
|
|
| T |
39166741 |
tgtgag |
39166736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University