View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1586_high_19 (Length: 245)
Name: NF1586_high_19
Description: NF1586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1586_high_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 49 - 206
Target Start/End: Complemental strand, 15631563 - 15631406
Alignment:
| Q |
49 |
ctcttgctttgtacaaaaattctgcaactccagatcagaaggtttttctctatatcttactttgttatctannnnnnnnnnnnnnctaatgctaaaaatt |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
15631563 |
ctcttgctttgtacaaaaattctgcaactccagatcagaaggtttttctctatatcttactttgttatctatttttatttttttcctaatgctaaaaatt |
15631464 |
T |
 |
| Q |
149 |
tgagatttaatacatattacatgcatagtgatgctgttttaaccgacagggtcttaaa |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
15631463 |
tgagatttaatacatattacatgcatagtgatgttgttttaaccgacagggtcttaaa |
15631406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 15631844 - 15631793
Alignment:
| Q |
1 |
ttaatcagtaaatattcgtgcagaagcaaccgaaacttgtagggatgcctct |
52 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15631844 |
ttaatcagtgaatattcgtgcagaagcaaccgaaacttgtagggatgcctct |
15631793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University