View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1586_low_17 (Length: 266)
Name: NF1586_low_17
Description: NF1586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1586_low_17 |
 |  |
|
| [»] scaffold0041 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0041 (Bit Score: 126; Significance: 5e-65; HSPs: 2)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 128 - 253
Target Start/End: Original strand, 77172 - 77297
Alignment:
| Q |
128 |
agtcaccaccattattttatactaatgatgttgtttgttatgtgaaggtttcaaggaacattgatcttgtgtatggaggaggaagcattggtctcatggg |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
77172 |
agtcaccaccattattttatactaatgatgttgtttgttatgtgaaggtttcaaggaacattgatcttgtgtatggaggaggaagcattggtctcatggg |
77271 |
T |
 |
| Q |
228 |
tttagtttctcaagctgttcatgatg |
253 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
77272 |
tttagtttctcaagctgttcatgatg |
77297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 1 - 64
Target Start/End: Original strand, 77045 - 77108
Alignment:
| Q |
1 |
tttttaccttcactgtttgcatttcaaagtaacggttaaaaatgtacttgtactaatgtaaatg |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
77045 |
tttttaccttcactgtttgcatttcaaagtaacggttaaaaatgtacttgtactaatgtaaatg |
77108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 126; Significance: 5e-65; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 128 - 253
Target Start/End: Complemental strand, 40889112 - 40888987
Alignment:
| Q |
128 |
agtcaccaccattattttatactaatgatgttgtttgttatgtgaaggtttcaaggaacattgatcttgtgtatggaggaggaagcattggtctcatggg |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40889112 |
agtcaccaccattattttatactaatgatgttgtttgttatgtgaaggtttcaaggaacattgatcttgtgtatggaggaggaagcattggtctcatggg |
40889013 |
T |
 |
| Q |
228 |
tttagtttctcaagctgttcatgatg |
253 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
40889012 |
tttagtttctcaagctgttcatgatg |
40888987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 1 - 64
Target Start/End: Complemental strand, 40889239 - 40889176
Alignment:
| Q |
1 |
tttttaccttcactgtttgcatttcaaagtaacggttaaaaatgtacttgtactaatgtaaatg |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40889239 |
tttttaccttcactgtttgcatttcaaagtaacggttaaaaatgtacttgtactaatgtaaatg |
40889176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 168 - 253
Target Start/End: Complemental strand, 28271513 - 28271428
Alignment:
| Q |
168 |
tgtgaaggtttcaaggaacattgatcttgtgtatggaggaggaagcattggtctcatgggtttagtttctcaagctgttcatgatg |
253 |
Q |
| |
|
||||||||| ||||| || |||||||| || ||||||||||||||||||||||| |||||||| ||||| |||||||||||||||| |
|
|
| T |
28271513 |
tgtgaaggtgtcaagaaatattgatctagtttatggaggaggaagcattggtctaatgggtttggtttcacaagctgttcatgatg |
28271428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 172 - 246
Target Start/End: Original strand, 21625303 - 21625377
Alignment:
| Q |
172 |
aaggtttcaaggaacattgatcttgtgtatggaggaggaagcattggtctcatgggtttagtttctcaagctgtt |
246 |
Q |
| |
|
||||| ||||| || |||||| | || ||||||||||| ||||||||| | ||||| || ||||||||||||||| |
|
|
| T |
21625303 |
aaggtgtcaagaaatattgatttggtttatggaggaggcagcattggtttgatggggttggtttctcaagctgtt |
21625377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 172 - 253
Target Start/End: Complemental strand, 40465899 - 40465818
Alignment:
| Q |
172 |
aaggtttcaaggaacattgatcttgtgtatggaggaggaagcattggtctcatgggtttagtttctcaagctgttcatgatg |
253 |
Q |
| |
|
||||| ||||| || ||||| || || ||||||||||| ||||||||| | ||||| || |||||||||||||| |||||| |
|
|
| T |
40465899 |
aaggtgtcaagaaatattgacctagtttatggaggaggcagcattggtttgatggggttgatttctcaagctgtttatgatg |
40465818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University