View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1586_low_18 (Length: 258)
Name: NF1586_low_18
Description: NF1586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1586_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 138
Target Start/End: Original strand, 41389270 - 41389407
Alignment:
| Q |
1 |
tatatacttttcaagtaagttaaatcaggccctccattttttgtcctaatacatgtccatgtattggattatatatgaaattcatcctcttgtacgttaa |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41389270 |
tatatacttttcaagcaagttaaatcaggccctccattttttgtccaaatacatgtccatgtattggattatatatgaaattcatcctcttgtacgttaa |
41389369 |
T |
|
| Q |
101 |
acaggttttctaaatttgatatttgatgcacaaatatg |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41389370 |
acaggttttctaaatttgatatttgatgcacaaatatg |
41389407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 198 - 254
Target Start/End: Original strand, 41389467 - 41389523
Alignment:
| Q |
198 |
aaaaatggactatgtataatgtagtagtactataaaactttcatcatgatgatgtcc |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41389467 |
aaaaatggactatgtataatgtagtagtactataaaactttcatcatgatgaggtcc |
41389523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University