View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1586_low_21 (Length: 245)
Name: NF1586_low_21
Description: NF1586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1586_low_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 26 - 228
Target Start/End: Original strand, 42071191 - 42071393
Alignment:
| Q |
26 |
gagcaatatgagactccaaacaaactacaaacaactttgaatatccactttcacgtcttgtatgggcatgagtccaatccccacacttcaatccttaatc |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
42071191 |
gagcaatatgagactccaaacaaactacaaacaactttcaatatctactttcacgtcttgtatgggcatgagttcaatcccgacacttcaatccttaatc |
42071290 |
T |
|
| Q |
126 |
aggctctaatccaccctcatgcacatttgtacttccaacagttcaaaaacttgagcaatgtacagtgacggatccataagttttgaatagtggggcacta |
225 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42071291 |
aggctctaatccaccctgatacacatttgtacttccaacagttcaaaaacttgagcaatgtacactgacggatccataagttttgaatagtggggcacta |
42071390 |
T |
|
| Q |
226 |
tat |
228 |
Q |
| |
|
||| |
|
|
| T |
42071391 |
tat |
42071393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University