View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1586_low_28 (Length: 221)
Name: NF1586_low_28
Description: NF1586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1586_low_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 3e-87; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 18 - 196
Target Start/End: Complemental strand, 48453512 - 48453334
Alignment:
| Q |
18 |
tggacatcatcttttctggattttaaacatcctacaagtttctcctcttctgcagaaactttcggttatggtgagcgaacatggttaatgcacacctttt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48453512 |
tggacatcatcttttctggattttaaacatcctacaagtttctcctcttttgcagaaacttttggttatggtgagcgaacatggttaatgcacacctttt |
48453413 |
T |
 |
| Q |
118 |
attattattattttttgtggttatcatcctgactttgagcaagaactttgtaaattaagttatacatttgatccttctt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
48453412 |
attattattattttttgtggttatcatcctgactttgagcaagaacttcgtaaattaagttatacatttgatacttctt |
48453334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 27 - 99
Target Start/End: Original strand, 47929059 - 47929131
Alignment:
| Q |
27 |
tcttttctggattttaaacatcctacaagtttctcctcttctgcagaaactttcggttatggtgagcgaacat |
99 |
Q |
| |
|
|||||| ||||||||||||||||| |||| ||||||||||||||||||||| || || |||||||| |||||| |
|
|
| T |
47929059 |
tcttttgtggattttaaacatccttcaagcttctcctcttctgcagaaactctctgtcatggtgagtgaacat |
47929131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 27 - 100
Target Start/End: Complemental strand, 47051406 - 47051333
Alignment:
| Q |
27 |
tcttttctggattttaaacatcctacaagtttctcctcttctgcagaaactttcggttatggtgagcgaacatg |
100 |
Q |
| |
|
|||||| |||||||||||||| || |||| |||||||||| ||||||||||||| | |||||||| ||||||| |
|
|
| T |
47051406 |
tcttttgtggattttaaacatgcttcaagcttctcctcttttgcagaaactttcaatcatggtgagtgaacatg |
47051333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 34 - 99
Target Start/End: Complemental strand, 48107571 - 48107506
Alignment:
| Q |
34 |
tggattttaaacatcctacaagtttctcctcttctgcagaaactttcggttatggtgagcgaacat |
99 |
Q |
| |
|
||||||||||||||||| ||||||| |||| || ||||||||||||| | |||||||| |||||| |
|
|
| T |
48107571 |
tggattttaaacatccttcaagtttgtccttttttgcagaaactttcagccatggtgagtgaacat |
48107506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University