View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15872_low_14 (Length: 207)
Name: NF15872_low_14
Description: NF15872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15872_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 13 - 184
Target Start/End: Complemental strand, 32959900 - 32959729
Alignment:
| Q |
13 |
gaaatgaaggagaaaaaatatgatagaaatgtacttacaatcttgcatgaaccaagttgaagaagaccatgtccagcttgaattacagctatggtctgct |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32959900 |
gaaaagaaggagaaaaaatatgatagaaatgtacttacaatcttgcatgaaccaagttgaagaagaccatgtccagcttgaattacagctatggtctgct |
32959801 |
T |
|
| Q |
113 |
catggaaacaaataaaatgagttgaaaaatcttaagaaatcaattaatccttgtgagaccaataataatagc |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32959800 |
catggaaacaaataaaatgagttgaaaaatcttaagaaatcaattaatccttgtgagaccaataataatagc |
32959729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University