View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15873_high_27 (Length: 257)
Name: NF15873_high_27
Description: NF15873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15873_high_27 |
 | |
|
| [»] scaffold0028 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0028 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 35 - 239
Target Start/End: Original strand, 75655 - 75859
Alignment:
| Q |
35 |
ccaacatgaaacatacatagagaaatatgatattgaattaatataggaaataaatgaaccttctttgnnnnnnncggatagaccaaaatcggtggccttg |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
75655 |
ccaacatgaaacatacatagagaaatatgatattgaattaatataggaaataaatgaaccttctttgaaaaagacggatagaccaaaatcggtggcctta |
75754 |
T |
|
| Q |
135 |
aggggtgcattttcatccttattcaacaagaggaaattttctggcttaagatctctatgaataacacccattgaatgcaaagtatgaattatttgcacaa |
234 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
75755 |
agaggtgcattttcatccttattcaacaagaggaaattttctggcttaagatctctatgaataacacccattgaatgcaaagtatgaataatttgcacaa |
75854 |
T |
|
| Q |
235 |
tggtt |
239 |
Q |
| |
|
||||| |
|
|
| T |
75855 |
tggtt |
75859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 111 - 239
Target Start/End: Original strand, 38810148 - 38810276
Alignment:
| Q |
111 |
gatagaccaaaatcggtggccttgaggggtgcattttcatccttattcaacaagaggaaattttctggcttaagatctctatgaataacacccattgaat |
210 |
Q |
| |
|
|||| ||| ||||| ||||| ||||| || | ||| |||||||| ||||||| || ||||| || ||||||||||||||||||||||||||||| |||| |
|
|
| T |
38810148 |
gataaaccgaaatcagtggctttgagaggagaattctcatccttgctcaacaaaagaaaattctcaggcttaagatctctatgaataacacccatggaat |
38810247 |
T |
|
| Q |
211 |
gcaaagtatgaattatttgcacaatggtt |
239 |
Q |
| |
|
| ||||||||| ||||| ||||||||| |
|
|
| T |
38810248 |
gacaagtatgaacaatttgaacaatggtt |
38810276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University