View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15873_low_19 (Length: 313)
Name: NF15873_low_19
Description: NF15873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15873_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 16 - 291
Target Start/End: Complemental strand, 35072626 - 35072342
Alignment:
| Q |
16 |
ataatactagtgattgataatgacgatgaacgtatgaggaaagtaaagcatcatgacaacttgcttagcttgaggatagaatttgcaacgtaaacaaaaa |
115 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35072626 |
ataatacaagtgattgataatgacgatgaacgtatgaggaaagtaaagcatcatgacaacttgcttagcttgaggatagaatttgcaacgtaaacaaaaa |
35072527 |
T |
|
| Q |
116 |
tcagaaataccaccaaaaatgtttgctataacaatttgggtaagaaacctagtagttgtgttcactatgacatattggcctg---------nnnnnnnnn |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35072526 |
tcagaaataccaccaaaaatgtttgctataacaatttgggtaagaaacctagtagttgtgttcactatgacatattggcctgttttttattttttatttt |
35072427 |
T |
|
| Q |
207 |
nnnggctttctggttcaacaatattgttgctttttatgtctttagtggaaagttgtaattggtcggctgaaaactgagatagctg |
291 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35072426 |
tttggctttgtggttcaacaatattgttgctttttatgtctttagtggaaagttgtaattggtcggctgaaaactgagatagctg |
35072342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University