View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15873_low_21 (Length: 295)
Name: NF15873_low_21
Description: NF15873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15873_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 272; Significance: 1e-152; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 1 - 280
Target Start/End: Complemental strand, 47582467 - 47582188
Alignment:
| Q |
1 |
aaacctggtcgagctgaaaggcgaggatttgtgggtgggggcagcacccaagaattattgtcgtctgccttgtggaatggatataattcaaatctaacac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47582467 |
aaacctggtcgagctgaaaggcgaggatttgtgggtggaggcagcacccaagaattattgtcgtctgccttgtggaatggatataattcaaatctaacac |
47582368 |
T |
|
| Q |
101 |
cacaactgggatataatattgtgcctccagattttcctctgcagcaactggttggaacttcagctatggcatcactaagacaccagctgcagttctctgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47582367 |
cacaactgggatataatattgtgcctccagattttcctctgcagcaactggttggaacttcagctatggcatcactaagacaccagctgcagttctctgc |
47582268 |
T |
|
| Q |
201 |
agataggcacgggaggcaccaagcaccgccatatactttttggttttctgtgaggttcactgacttgacagcaaattttg |
280 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47582267 |
agataggcatgggaggcaccaagcaccgccatatactttttggttttctgtgaggttcactgacttgacagcaaattttg |
47582188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 57 - 279
Target Start/End: Complemental strand, 47572713 - 47572491
Alignment:
| Q |
57 |
attgtcgtctgccttgtggaatggatataattcaaatctaacaccacaactgggatataatattgtgcctccagattttcctctgcagcaactggttgga |
156 |
Q |
| |
|
||||| || |||||||||||| |||| ||| |||||| ||| ||||||||||||||| ||||||| |||||||||||||||||||| ||||| |||||| |
|
|
| T |
47572713 |
attgttgtgtgccttgtggaaaggatttaagtcaaatttaagaccacaactgggataaaatattgctcctccagattttcctctgcaacaactagttgga |
47572614 |
T |
|
| Q |
157 |
acttcagctatggcatcactaagacaccagctgcagttctctgcagataggcacgggaggcaccaagcaccgccatatactttttggttttctgtgaggt |
256 |
Q |
| |
|
| ||| ||||||||||| |||||||||||||| ||||| |||| ||||||| | |||| ||||||| || ||||||| ||||||||| ||||||| | |
|
|
| T |
47572613 |
atttctgctatggcatcgctaagacaccagctacagttttctgaagataggtatgggacgcaccaaacataaccatatagtttttggttgtctgtgatat |
47572514 |
T |
|
| Q |
257 |
tcactgacttgacagcaaatttt |
279 |
Q |
| |
|
|||||||||| |||| |||||| |
|
|
| T |
47572513 |
tcactgacttatcagccaatttt |
47572491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University