View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15873_low_22 (Length: 291)
Name: NF15873_low_22
Description: NF15873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15873_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 18 - 272
Target Start/End: Original strand, 48644600 - 48644854
Alignment:
| Q |
18 |
aaaagttgatgaaagaaccatgaagaagcttctagaagttgctattgatgctcttaaaataaataatattaagcttgcaaatagacaagttcaaaagatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48644600 |
aaaagttgatgaaagaaccatgaagaagcttctagaagttgctattgatgctcttaaaataaataatattaagcttgcaaatagacaagttcaaaagatt |
48644699 |
T |
 |
| Q |
118 |
cataggctttatggtatgtggaagaggaacatgcaccgtcttgatgctacggaggtggtgcttaaggagaaaacgtgggaggaatgtgttttgacaaaga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
48644700 |
cataggctttatggtatgtggaagaggaacatgcaccgtcttgatgctacggaggtggtgcttaaggagaaaacttgggaggattgtgttttgacaaaga |
48644799 |
T |
 |
| Q |
218 |
gtcttaggattgttcacaagtttctatacgatgattgttcagtacgtgttagaaa |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
48644800 |
gtcttaggattgttcacaagtttctatacgatgattgttcagtgcgtgttagaaa |
48644854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University