View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15873_low_31 (Length: 252)
Name: NF15873_low_31
Description: NF15873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15873_low_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 16 - 233
Target Start/End: Complemental strand, 48729286 - 48729069
Alignment:
| Q |
16 |
atgaaggacatgttgatcaaagcaggagctttgcatggtttttcacttgctcctactccgcttcacgaagagctacgatcaaaaatcacatttaacgaga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
48729286 |
atgaaggacatgttgatcaaagcaggagctttgcatggtttttcacttgctcctactccgcttcacgaagagctacaatcaaaaatcacatttaacgaga |
48729187 |
T |
 |
| Q |
116 |
gaatagcaatttgtgttactcgtttaagaaggagaatttcaagtgacacaagaaacgctttgttagtagttgctattcttttcgcaacaagtgcatatga |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48729186 |
gaatagcaatttgtgttactcgtttaagaaggagaatttcaagtgacacaagaaacgctttgttagtagttgctattcttttcgcaacaagtgcatatga |
48729087 |
T |
 |
| Q |
216 |
agcaacacttaaccctcc |
233 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
48729086 |
agcaacacttaaccctcc |
48729069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University