View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15875_high_36 (Length: 308)
Name: NF15875_high_36
Description: NF15875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15875_high_36 |
 | |
|
| [»] chr5 (3 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 30 - 308
Target Start/End: Complemental strand, 4132626 - 4132329
Alignment:
| Q |
30 |
agtcaggtctgagaatgtgcccccgaaagtttgtgttgaacacaatggctcttttgataaaaacatggaggtaaaaaattctgatttctccagtaaatct |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4132626 |
agtcaggtctgagaatgtgcccccgaaagtttgtgttgaacacaatggctcttttgataaaaacatggaggtaaaaaattctgatttctctagtaaatct |
4132527 |
T |
|
| Q |
130 |
ctgttatagaattaattgtaaataatacacctttggttgatgatcaatggtcctaaattctgaacatgcatatttgtaatatg----------------- |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4132526 |
ctgttatagaattaattgtaaataatacacctttggttgatgatcaatggtcctaaattctgaacatgcatatttgtaatatggtgacatatttgtaata |
4132427 |
T |
|
| Q |
213 |
--gtgataaacattctgataggatattgtttactttgccaaggctcaaaggtaaacatttatgttcacttgcacctagaagtagatcattcagttagt |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4132426 |
tggtgataaacattctgataggatattgtttactttgccaaggctcaaaggtaaacatttatgttcacttgcacctagaagtagatcattcagttagt |
4132329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 35 - 104
Target Start/End: Complemental strand, 4109436 - 4109367
Alignment:
| Q |
35 |
ggtctgagaatgtgcccccgaaagtttgtgttgaacacaatggctcttttgataaaaacatggaggtaaa |
104 |
Q |
| |
|
|||| |||||||||| ||||||||||||||| |||||||| || ||||||||||||||||||||||||| |
|
|
| T |
4109436 |
ggtccgagaatgtgcaaccgaaagtttgtgttcaacacaatagcacttttgataaaaacatggaggtaaa |
4109367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 231 - 306
Target Start/End: Complemental strand, 4109195 - 4109118
Alignment:
| Q |
231 |
ggatattgtttactttgccaaggctcaaaggtaaacatttatg--ttcacttgcacctagaagtagatcattcagtta |
306 |
Q |
| |
|
||||||||||||||||| ||| |||||||| |||||||||| ||| ||||||||| || ||||||||||||||| |
|
|
| T |
4109195 |
ggatattgtttactttggcaaacttcaaaggtgaacatttatgctctcatttgcacctaaaaatagatcattcagtta |
4109118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University