View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15876_high_1 (Length: 594)
Name: NF15876_high_1
Description: NF15876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15876_high_1 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 558; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 558; E-Value: 0
Query Start/End: Original strand, 1 - 594
Target Start/End: Complemental strand, 30715907 - 30715314
Alignment:
| Q |
1 |
cttacacgttccttctcaccttgaagaatccccataagttctgacctgaactcctcaacgggttcaatttcgtaataggcttgtaaaaacgacaacttga |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30715907 |
cttacacgttccttctcaccttgatgaatccccataagttctgaccttaactcctcaacgggttcaatttcgtaataggcttgtaaaaacgacaacttga |
30715808 |
T |
 |
| Q |
101 |
tttcatcccatgaaagagaaatgtaataaggctcgatgttgaggtcgtaccatagtgcagattcttcttcaagtgtgacagggaagatcttcttttgcat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30715807 |
tttcatcccatgaaagagaaatgtaataaggctcgatgttgaggtcgtaccatagtgcagattcttcttcaagtgtgacagggaagatcttcttttgcat |
30715708 |
T |
 |
| Q |
201 |
ttcaacggaggatgcattgtttgctctacatactttgttgaaacgactcaaatgggttattggggattcgtttggagtgccatgaaaaattggtaaagga |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30715707 |
ttcaacggaggatgcattgtttgctctacatactttgttgaaacgactcaaatgggttattggggattcgtttggagtgccacgaaaaattggtaaagga |
30715608 |
T |
 |
| Q |
301 |
gcgattggtatgtatgaagatgcattcatgggttgtgtgggatttgggacattataagaagaaactgaagggctttctggaacattgccaatgtgtgctt |
400 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30715607 |
gcgatttgtatgtatgaagatgcattcatgggttgtgtgggatttcggacattataagaagaaactgaagggctttctggaacattgccaatgtgtgctt |
30715508 |
T |
 |
| Q |
401 |
cttgtgagaaagatggtttaccatgtggtgcattggacaaggattcagaaacatcatcgtcatcgtcatcattgtcttcttcctctttttcggtttcatc |
500 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
30715507 |
cttgtgagaaagatggtttaccatgtggtgcattggacaaggattcagaaacatcatcgtcatcgtcatcattgtcttcttcctcttcttcggtttcatc |
30715408 |
T |
 |
| Q |
501 |
ttcaaattgtcggtgttgatcctcttgagatttagaatccacatcgtttgcatcagtactattattatcgttgtcctcgtctttgtattcttct |
594 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30715407 |
ttcaaactgtcggtgttgatcctcttgagattcagaatccacatcgtctgcatcagtactattattatcgttgtcctcgtctttgtattcttct |
30715314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University